There is a great deal of interest today for genetic tests and you can find genetic testing companies that offer Y DNA, mitochondrial DNA (mtDNA) and autosomal DNA tests.
The tests that seem to elicit great interest pertain to Y DNA tests. There are a number of genetic testing companies that offer such tests and I would strongly recommend any interested person to study their offers before making a decision. The following information may be helpful in making your choice.
Only men have a Y chromosome. This opens up a unique opportunity to trace ancestry because fathers pass on their Y DNA to their sons with few changes from generation to generation. A son can thus compare his Y DNA to that of his father, grandfather, great grandfather and so on as well as those related to him through his father, grandfather, great grandfather (e.g. their siblings, the siblings’ children) and so on and identify his close as well as distant relatives.
To carry out DNA analyses, genetic testing companies have two options in the case of Y DNA:
Y STR and Y SNP tests
STR are the initials of Short Tandem Repeat also known as microsatellites. DNA is made up of four nucleotides designated A, C, T, and G. The DNA in our genes contain repeating sequences of these nucleotides, for example CTCTCTCT or GATAGATAGATAGATA. The number of repeats can change over time, for example CTCTCTCTCTCT or GATAGATAGATAGATAGATAGATA and these changes are passed on from father to son from generation to generation. They are thus a unique identifying signature for a specific lineage.
The rate of mutations of these repeats are of the order of 10-6 to 10−2 nucleotides (nt) per generation.
In a Y STR test, these repeats are identified at specified locations of the chromosome called genetic markers or “landmarks” on a chromosome. The reliability of the results increases with the increase in the number of the genetic markers studied. For example, the precision of a STR test with 12 markers is very low and not offered any longer by genetic testing companies. The entry level for a Y STR test today is 37 markers. The results can be used to find matches that would then need to be tested using a higher number of markers, typically 111 markers. At this latter level, one can identify the TMRCA or Time to the Most Recent Common Ancestor with reasonable precision.
SNP are the initials of Single Nucleotide Polymorphism. What this means is that a single nucleotide A, C, T, or G changes or mutates, for example a A is replaced by T or C is replaced by G. These changes are also unique and passed down from father to son from generation to generation and serve as identifiers of a lineage.
The rate of mutation of SNPs is of the order of 10-9 nt per generation.
SNPs change at a much slower rate than STRs. They are much more stable and significantly more precise to determine TMRCA between matching individuals.
A full chromosome test, for example the Big Y-700 test offered by Family Tree DNA analyses 700 genetic markers as well thousands of SNPs to find genetic matches between individuals as well as TMRCA with good precision.
