https://www.wired.com/story/is-23andme-dead-at-home-genetic-testing-anne-wojcicki/
How did Neanderthals and other ancient humans learn to count?
Friday, 4 October 2024
Monday, 29 July 2024
Early human origins probably involved different regions of Africa
Source: The Washington Post
The picture of early-human origins in Africa grows more complex
For decades, scientists who studied early modern humans believed that our ancestors initially inhabited only small areas of Africa, the savannas of the eastern and southern part of the continent, and then moved north into Asia, Europe and beyond. In this view, early humans bypassed West and Central Africa, especially tropical forests. These areas, the argument went, were populated much later.
But now, a growing group of researchers has cast doubt on this narrative. Working in Senegal, Cameroon, Malawi and elsewhere, they are uncovering evidence that early humans spread across much more of Africa before venturing elsewhere. This work has moved the field beyond the old out-of-Africa narrative and is transforming our understanding of how multiple groups of early modern humans intermingled and spread across the continent, providing a more nuanced picture of our species’ complex origins.
“It’s becoming more and more clear that humans didn't originate in a single population in one region of Africa,” says Eleanor Scerri, an archaeologist at the Max Planck Institute of Geoanthropology in Jena, Germany. “If we really want to understand human evolution, we need to look at all of the African continent.”
Most researchers agree that early modern humans emerged in Africa between 200,000 and 300,000 years ago. About 60,000 years ago, they spread to other parts of the world. Until recently, though, most experts thought these humans populated West and Central Africa, especially the tropical forests there, only within the past 20,000 or so years.
For some researchers, this narrative made little sense. “Humans like to move around a lot,” says University of Pennsylvania geneticist Sarah Tishkoff, who has been working to unravel Africa’s deep genetic lineage for more than two decades. “They had this beautiful continent, they could move all over, go to different niches, with different resources.”
The reason no one found evidence of early human settlement in West and Central Africa, Scerri and others say, is that few people had looked there. For many decades, most researchers tended to focus on low-hanging fruit — areas of the continent where fieldwork was less difficult. Because the climate is dryer and cooler in East and South Africa and the terrain is more open, fossils are easier to find and date. Most of West and Central Africa is hot and humid, so bones and DNA degrade more quickly. In addition, that region can be a challenging place to work, not only because much of it is thickly forested, but also because some areas are enmeshed in long-running and chaotic conflicts.
Some research suggests that cultural bias may also have played a role. “Most research has been spearheaded by people from the global North,” says Yale University paleoanthropologist Jessica Thompson. “And their perspective is, ‘Well, we want to know how people got out of Africa, to where we come from.”
As a result of all these factors, most scientists have focused largely on sites in South and East Africa. This has contributed to the idea that early modern humans primarily inhabited these regions. Frustrated that the academic establishment didn’t take their ideas seriously, a few researchers began trying to uncover evidence that supported their views. Over the past decade or so, they’ve found it.
Last year, a group that included scientists from Senegal, Europe and the United States reported that modern humans had lived at a site on the coast of Senegal 150,000 years ago. Previous estimates put the earliest human habitation in West Africa at 30,000 years ago.
Moreover, the site was in a mangrove forest, rather than the typical grassland or sparse savanna usually associated with early-human habitation. Scerri says her latest research in Senegal, not yet published, may push this date back even further. “It’s clear that there were different people in different places doing different things,” she says. “And they were there for a long time. A lot longer than we realized.”
Another study, from 2022, analyzed DNA from the bones of 34 people who lived across sub-Saharan Africa between 5,000 and 18,000 years ago. Examining such ancient DNA is important because it offers a much clearer window onto the structure of more ancient African populations. The research showed that from 80,000 to 20,000 years ago, populations that had been fairly isolated from one another began to interact across large swaths of the continent. These links spanned thousands of miles, from Ethiopia, through Central African forests and down to South Africa.
“People were clearly moving quite broadly across Africa,” says Thompson, one of the study’s co-authors. “They were not staying in these little isolated populations.”
And a paper published four years ago in Nature examined the remains of two children found at a rock shelter in Cameroon, in the western part of Central Africa. One of the children lived 3,000 years ago, while the other lived 8,000 years ago. The researchers, from Harvard and other institutions, managed to collect DNA from the two — the first ancient human DNA ever sequenced from Central Africa. They detected four separate human lineages between 60,000 and 80,000 years ago, including a previously unknown lineage — what they called a “ghost population” — that probably lived in West Africa. The results provide more support for the idea that humans have been in West Africa for far longer than previously realized and adds to the evidence that humanity’s roots exist across more than one region of Africa.
Experts say it’s important to note that close relatives of modern humans — Neanderthals, Homo erectus and several other species — had already spread beyond Africa to Europe and Asia, in some cases millions of years ago. But these groups contributed relatively small amounts of DNA to the modern human lineage.
Because it can be so difficult to find fossils and retrieve ancient DNA in many parts of Africa, scientists have had to develop innovative approaches to establish early-human habitation. For instance, Thompson and her colleagues studied sediments around Lake Malawi in the northern part of the country. Over thousands of years, the lake shrank and grew, depending on the amount of rainfall. During wetter periods, the number of trees around the lake would expand significantly.
But Thompson found that during a wetter period starting 80,000 years ago (and continuing today), the number of trees did not increase nearly as much as expected. Instead, the scientists found an abundance of charcoal. Thompson says this shows that humans were living in the region, perhaps in fairly large numbers, and were burning wood on a significant scale, either to modify the environment for hunting or to cook or keep warm — or all three.
A key aspect of this new understanding is the Pan-African hypothesis: Scerri and others argue that modern humans probably evolved from the intermingling of different groups from a range of areas of the continent. “There were a number of modern human populations living in different regions of Africa, and we emerged over time from the complex interactions between them,” Scerri says. “Basically, we’re a mix of a mix of a mix of a mix.”
In research published last year, University of California at Davis population geneticist Brenna Henn and her colleagues examined the genomes of almost 300 Africans from across the continent. By analyzing and comparing the genetic data, they were able to construct a model for how humans originated within the continent over the past several hundred thousand years. They found that modern humans descended from at least two distinct populations who lived in different parts of the continent. She and her colleagues are now analyzing genomes from 3,000 people, mostly Africans but also people of African descent who live elsewhere, as well as Indigenous Americans and others.
Scerri has also found evidence to support the Pan-African idea. She has shown that Middle Stone Age culture persisted in West Africa until quite recently, less than about 11,000 years ago. This culture, a particular way of making stone tools, disappeared much earlier in other parts of the continent, 30,000 to 50,000 years ago. This is important, she says, because it is precisely what the Pan-African theory predicts: “In this model, you’d expect that each region would have its own distinctive cultural trajectory, due to periods of isolation. This research shows how this was possible.”
Not everyone is convinced. Richard Klein, a paleoanthropologist at Stanford University who has spent decades studying early modern human origins and migration in Africa, says, “I don’t understand the evolutionary mechanism behind” the pan-African origins theory.
Pontus Skoglund, a population geneticist at the Francis Crick Institute in London who has collaborated with Scerri, says that the Pan-African idea is plausible, but that he isn’t fully persuaded. “To me, it also seems possible that a large portion of present-day people’s ancestry might be found in a single region,” he says. “But we don’t know.” He says there is still “a lot of uncertainty” about who was where and when.
Scerri agrees that more research is needed. But after years of fighting skepticism, she says she feels vindicated that the new perspective has caught on. “Right now, this is such an exciting area to work,” she says. “It’s really an incredible story, one that’s emerging before our eyes.”
Tuesday, 16 July 2024
The origin of all living organisms
About 4.2 million years ago, a microbe emerged with a fairly large genome encoding, that further led through evolution to all the living organisms that we know today as well as those that are now extinct. We do not know how or from where this microbe emerged.
Go to the link below for a fascinating account of the detective work related to the origins of living organisms:
Monday, 10 June 2024
Genetic Tests: Y STR and Y SNP
There is a great deal of interest today for genetic tests and you can find genetic testing companies that offer Y DNA, mitochondrial DNA (mtDNA) and autosomal DNA tests.
The tests that seem to elicit great interest pertain to Y DNA tests. There are a number of genetic testing companies that offer such tests and I would strongly recommend any interested person to study their offers before making a decision. The following information may be helpful in making your choice.
Only men have a Y chromosome. This opens up a unique opportunity to trace ancestry because fathers pass on their Y DNA to their sons with few changes from generation to generation. A son can thus compare his Y DNA to that of his father, grandfather, great grandfather and so on as well as those related to him through his father, grandfather, great grandfather (e.g. their siblings, the siblings’ children) and so on and identify his close as well as distant relatives.
To carry out DNA analyses, genetic testing companies have two options in the case of Y DNA:
Y STR and Y SNP tests
STR are the initials of Short Tandem Repeat also known as microsatellites. DNA is made up of four nucleotides designated A, C, T, and G. The DNA in our genes contain repeating sequences of these nucleotides, for example CTCTCTCT or GATAGATAGATAGATA. The number of repeats can change over time, for example CTCTCTCTCTCT or GATAGATAGATAGATAGATAGATA and these changes are passed on from father to son from generation to generation. They are thus a unique identifying signature for a specific lineage.
The rate of mutations of these repeats are of the order of 10-6 to 10−2 nucleotides (nt) per generation.
In a Y STR test, these repeats are identified at specified locations of the chromosome called genetic markers or “landmarks” on a chromosome. The reliability of the results increases with the increase in the number of the genetic markers studied. For example, the precision of a STR test with 12 markers is very low and not offered any longer by genetic testing companies. The entry level for a Y STR test today is 37 markers. The results can be used to find matches that would then need to be tested using a higher number of markers, typically 111 markers. At this latter level, one can identify the TMRCA or Time to the Most Recent Common Ancestor with reasonable precision.
SNP are the initials of Single Nucleotide Polymorphism. What this means is that a single nucleotide A, C, T, or G changes or mutates, for example a A is replaced by T or C is replaced by G. These changes are also unique and passed down from father to son from generation to generation and serve as identifiers of a lineage.
The rate of mutation of SNPs is of the order of 10-9 nt per generation.
SNPs change at a much slower rate than STRs. They are much more stable and significantly more precise to determine TMRCA between matching individuals.
A full chromosome test, for example the Big Y-700 test offered by Family Tree DNA analyses 700 genetic markers as well thousands of SNPs to find genetic matches between individuals as well as TMRCA with good precision.
Wednesday, 29 May 2024
Iasi et al have determined when and for how long Neanderthals and humans intermingled
https://www.nature.com/articles/d41586-024-01452-3
- NEWS
Neanderthal–human baby-making was recent — and brief
Neanderthals (reconstruction, right, and fossil) and Homo sapiens started to have children together some 47,000 years ago.Credit: Justin Tallis/AFP via Getty
Some 60,000 years ago, Neanderthals in western Eurasia acquired strange new neighbours: a wave of Homo sapiens migrants making their way out of Africa, en route to future global dominance. Now, a study1 of hundreds of ancient and modern genomes has pinpointed when the two species began pairing off — and has found that the genetic intermingling lasted for only a short time, at least on an evolutionary scale.
The high-resolution analysis also allowed the authors to track when certain Neanderthal DNA sequences appeared in the H. sapiens genome and determine whether they were retained. The findings were published earlier this month on the preprint server bioRxiv. They have not yet been peer reviewed.
Genetic legacy
Relations between a good number of humans and Neanderthals (Homo neanderthalensis) must have been cordial: almost every living individual not of African ancestry carries genetic remnants of past pairings between the two species. Previous estimates indicated that this mixing occurred over a broad period between 50,000 and 60,000 years ago2,3, but the actual timing of this ‘gene flow’ and its long-term consequences remain poorly understood.
Earlier studies2,3 tried to understand this history by comparing contemporary human genomes with a small number of Neanderthal ones. But this approach makes it challenging for researchers to define where Neanderthal sequences in the modern genome start and end.
To address this challenge, Leonardo Iasi, an evolutionary geneticist at the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany, and his colleagues analysed 58 individuals who lived between 2,200 and 45,000 years ago and compared their DNA with that of 231 modern individuals of diverse ancestries other than African ones. People of full African ancestry don’t carry substantial amounts of Neanderthal DNA because their forebears were not part of the exodus from the continent while Neanderthals were alive.
This large-scale, multi-millennia-spanning comparison made it more straightforward to monitor ‘introgression’ of Neanderthal-derived sequences into the modern human genome. The results indicated that Neanderthal-derived genetic contributions in the modern samples could be traced to a single ‘pulse’ of gene flow starting roughly 47,000 years ago — more recently than originally projected —and spanning some 6,800 years, ending around the same time that Neanderthals were nearing extinction. Nearly 7,000 years might seem like a long time, but it is remarkably short on evolutionary timescales considering the sizable changes that the human genome underwent.
Neanderthal deserts
Notably, many of the Neanderthals’ genomic contributions were subsequently removed with remarkable speed from the H. sapiens genome. Modern human genomes contain vast ‘deserts’ that have been fully cleared of Neanderthal remnants — but the authors detected these deserts even in ancient genomes from the latest stages of human–Neanderthal interaction. According to Emilia Huerta-Sanchez, an evolutionary biologist at Brown University in Providence, Rhode Island, this suggests that many Neanderthal sequences could have been detrimental to humans, and were therefore actively and rapidly selected against by evolution.
Huerta-Sanchez says this work fills important gaps in ancient human history. “One of the strengths of the study is that by incorporating ancient human genomes, they learnt more about how evolutionary forces have shaped Neanderthal variation in human populations,” she says.
But other gaps remain. For example, ancestral human genomic data from some geographical regions, including Oceania and East Asia, are much scarcer than from western Eurasia. East Asia is particularly intriguing, because modern humans in the region retain especially high levels of Neanderthal DNA — roughly 20% more than do European people.
The authors declined to speak to Nature for this article.
doi: https://doi.org/10.1038/d41586-024-01452-3
References
Iasi, L. N. M. et al. Preprint at bioRxiv https://doi.org/10.1101/2024.05.13.593955 (2024).
Hajdinjak, M. et al. Nature 592, 253–257 (2021).
Villanea, F. A. & Schraiber, J. G. Nature Ecol. Evol. 3, 39–44 (2019).
Wednesday, 8 May 2024
Subscribe to:
Posts (Atom)